Journal: Arthritis Research & Therapy

Article Title: Meniscal and ligament modifications in spontaneous and post-traumatic mouse models of osteoarthritis

doi: 10.1186/s13075-020-02261-5

Figure Lengend Snippet: Representative images of meniscal pathology during spontaneous osteoarthritis development in Str/ort mice. a Toluidine blue, Collagen type II (Col2) and Sox9 immunolabelling in healthy CBA mouse meniscus, which can be divided into distinct regions: hyaline cartilage (H) surrounds an ossified region (O) and an outer fibrous (F) region. b – d Representative images from diseased menisci from Str/ort mouse knee joints with OA grades of 2 (mild), 4 (moderate) and 5 (severe). Toluidine blue staining showed a range of meniscal pathologies associated with OA development including an increase in the fibrous region (delineated by red lines), proteoglycan deposition and bone formation (red arrows). Col2- and sox9-positive cells (black arrows) were seen in the fibrous region of the meniscus with disease showed. Low mag = low magnification, scale bar = 100 μm; High mag = high magnification, scale bar = 50 μm. For orientation: femur at top of picture, tibia bottom

Article Snippet: Non-specific binding sites were blocked for 1 h (Col2: MoM Kit, Vector Labs, BMK-2202; Sox9: 10% v/v goat serum).

Techniques: Staining

Journal: Arthritis Research & Therapy

Article Title: Meniscal and ligament modifications in spontaneous and post-traumatic mouse models of osteoarthritis

doi: 10.1186/s13075-020-02261-5

Figure Lengend Snippet: Representative images of cruciate ligament changes with OA development in Str/ort mice. a Toluidine blue, Collagen type II (Col2) and Sox9 immunolabelling in healthy CBA mouse cruciate ligaments, with high magnification of insertion site into the tibia. b , c Cruciate ligaments from Str/ort mouse knee joints with OA grades of 2 (mild) and 5 (severe). Toluidine blue staining showed increased staining at the insertion site (high mag for panels b and c ) and within the ligament body (high mag for panel c ), with hypertrophy of local cells. Col2 deposition and sox-9 positive cells were also increased, especially in severe diseased joints. Low mag = low magnification, scale bar = 100 μm; High mag = high magnification, scale bar = 50 μm. For orientation: femur at top of picture, tibia bottom

Article Snippet: Non-specific binding sites were blocked for 1 h (Col2: MoM Kit, Vector Labs, BMK-2202; Sox9: 10% v/v goat serum).

Techniques: Staining

Journal: Arthritis Research & Therapy

Article Title: Meniscal and ligament modifications in spontaneous and post-traumatic mouse models of osteoarthritis

doi: 10.1186/s13075-020-02261-5

Figure Lengend Snippet: Representative images of collateral ligaments in OA Str/ort mouse knee joints. a Toluidine blue, collagen type II (Col2) and Sox9 immunolabelling in healthy CBA mouse collateral ligaments, with high magnification of the body of the ligament. b Collateral ligaments from Str/ort mouse knee joints with OA grades of 5 (severe). Toluidine blue staining showed increased staining with hypertrophy of local cells. Col2 deposition and sox9-positive cells were also increased. c Very severe OA joints showed severe changes including ossification within the body of the ligament (red arrows) and areas of col2 deposition and Sox9-expressing cells (black arrows). Low mag = low magnification, scale bar = 100 μm; High mag = high magnification, scale bar = 50 μm. For orientation: femur at top of picture, tibia bottom

Article Snippet: Non-specific binding sites were blocked for 1 h (Col2: MoM Kit, Vector Labs, BMK-2202; Sox9: 10% v/v goat serum).

Techniques: Staining, Expressing

Journal: Arthritis Research & Therapy

Article Title: Meniscal and ligament modifications in spontaneous and post-traumatic mouse models of osteoarthritis

doi: 10.1186/s13075-020-02261-5

Figure Lengend Snippet: Representative images of meniscus and ligament modifications during post-traumatic OA in DMM joints. a Staining of the contralateral control meniscus. b Toluidine blue staining showed meniscal changes in the DMM mice associated with OA development, including bone formation in the fibrous meniscal attachment site, proteoglycan and bone deposition (red arrow). Col2 deposition was also seen at the sites of high toluidine Blue staining with Sox9-expressing cells (black arrows). c Cruciate ligament insertion site in DMM joints showed areas of strong toluidine blue staining, concomitant with col2 deposition and Sox9 expression. Low mag = low magnification, scale bar = 100 μm; High mag = high magnification, scale bar = 50 μm

Article Snippet: Non-specific binding sites were blocked for 1 h (Col2: MoM Kit, Vector Labs, BMK-2202; Sox9: 10% v/v goat serum).

Techniques: Staining, Expressing

Journal: Cell Reports

Article Title: TIAM1-RAC1 promote small-cell lung cancer cell survival through antagonizing Nur77-induced BCL2 conformational change

doi: 10.1016/j.celrep.2021.109979

Figure Lengend Snippet:

Article Snippet: The following TIAM1 human DNA sequence were mutated from GGATCCTCAAG TACCC ACTTCTGCTCAGGG to GGATCGCCAAGTACCCAGCTGCGGCCAGGG using Q5® Site-Directed Mutagenesis (New England Biolabs) according to the manufacturer’s instructions.

Techniques: Recombinant, In Vivo, Transfection, Produced, Binding Assay, Purification, Staining, Protease Inhibitor, Cell Viability Assay, Mutagenesis, Generated, Plasmid Preparation, Software

Journal: Leukemia

Article Title: IDH1 and IDH2 mutations in pediatric acute leukemia

doi: 10.1038/leu.2011.133

Figure Lengend Snippet: Genetic characteristics of the 515 pediatric leukemias analyzed

Article Snippet: 20 Site Directed Mutagenesis Human wildtype (WT) cDNA clones for IDH1 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_005896.2","term_id":"28178824","term_text":"NM_005896.2"}} NM_005896.2 ) and IDH2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002168.2","term_id":"28178831","term_text":"NM_002168.2"}} NM_002168.2 ) in pCMV6 Entry vector were obtained from Origene (Origene, Rockville, MD).

Techniques:

Journal: Leukemia

Article Title: IDH1 and IDH2 mutations in pediatric acute leukemia

doi: 10.1038/leu.2011.133

Figure Lengend Snippet: Genomic structure of IDH1 and IDH2 and structural model of the location of R140 and R172 in the substrate-binding pocket of IDH2. (a) Illustration of the exon/intron structure of IDH1 and IDH2. The location within exon 4 of codon R132 in IDH1 and codon R140 in IDH2 are marked by arrows, and the surrounding nucleotide sequence and encoded amino acids are highlighted. Codon R132 in IDH1 and the homologous residue R172 in IDH2 are shown in red and codon 140 in IDH2 is shown in blue. (b) Model of the positions of the R140 and R172 amino acids in the IDH2 substrate binding pocket. The two protomers in the IDH2 homodimer are illustrated in green and purple, with the nitrogen atoms in amino acids R140 and R172 shown in blue. The bound substrate, isocitrate, is depicted with carbon atoms as yellow sticks and oxygen atoms in red. The manganese ion is shown as a grey sphere. Salt-bridges and hydrogen bonds are shown as dashed lines.

Article Snippet: 20 Site Directed Mutagenesis Human wildtype (WT) cDNA clones for IDH1 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_005896.2","term_id":"28178824","term_text":"NM_005896.2"}} NM_005896.2 ) and IDH2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002168.2","term_id":"28178831","term_text":"NM_002168.2"}} NM_002168.2 ) in pCMV6 Entry vector were obtained from Origene (Origene, Rockville, MD).

Techniques: Binding Assay, Sequencing

Journal: Leukemia

Article Title: IDH1 and IDH2 mutations in pediatric acute leukemia

doi: 10.1038/leu.2011.133

Figure Lengend Snippet: Genetic characteristics of the AMLs with IDH1 / IDH2 mutations

Article Snippet: 20 Site Directed Mutagenesis Human wildtype (WT) cDNA clones for IDH1 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_005896.2","term_id":"28178824","term_text":"NM_005896.2"}} NM_005896.2 ) and IDH2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002168.2","term_id":"28178831","term_text":"NM_002168.2"}} NM_002168.2 ) in pCMV6 Entry vector were obtained from Origene (Origene, Rockville, MD).

Techniques: Mutagenesis

Journal: Leukemia

Article Title: IDH1 and IDH2 mutations in pediatric acute leukemia

doi: 10.1038/leu.2011.133

Figure Lengend Snippet: Enzymatic analysis of the IDH1 and IDH2 mutant proteins. The activity of recombinant IDH1 and IDH2 proteins to catalyze the NADP+-dependent oxidative decarboxylation of isocitrate to α-KG using 30uM Isocitrate and 100uM NADP are shown in panels a and b, respectively, and their ability to catalyze the NADPH-dependent reduction of α–KG to 2-HG using 0.5 mM α-KG and 100uM NADPH are shown in c and d, respectively. All graphs are based on triplicate measurements with the mean ± standard deviations expressed as a relative level compared to WT:WT homodimers, with the latter set as 100%. The SD in panel c and d are < 0.03 and are thus below the resolution of the figure. (e) The intracellular level of 2-HG was measured by liquid chromatography/mass spectrometry in pediatric AML cells from primary diagnostic bone marrow samples. The data for mutant IDH1/IDH2 includes two leukemia samples containing IDH1 mutations (one with R132H and one with R132C, ▴), and two containing the R140Q IDH2 mutations (◆). The wild-type IDH1/IDH2 data was generated using two pediatric AML samples that lacked mutations in either IDH1 or IDH2 (●).

Article Snippet: 20 Site Directed Mutagenesis Human wildtype (WT) cDNA clones for IDH1 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_005896.2","term_id":"28178824","term_text":"NM_005896.2"}} NM_005896.2 ) and IDH2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002168.2","term_id":"28178831","term_text":"NM_002168.2"}} NM_002168.2 ) in pCMV6 Entry vector were obtained from Origene (Origene, Rockville, MD).

Techniques: Mutagenesis, Activity Assay, Recombinant, Liquid Chromatography, Mass Spectrometry, Diagnostic Assay, Generated